Zeb2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

  • Retired Cat.No.

    50813116
  • Product Name

    Zeb2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
  • Unit

    3 x 1.0 µg DNA
  • Description

    Save 30% OFF Packaging Mix or Transduction Enhancer with any lentivector or lentivirus. Click here to claim your savings!
    abm's Knockout sgRNA vectors and viruses are ready to use in your CRISPR Gene Knockout experiment. These vector and virus products come as a set of three sgRNA targets which are designed to guide Cas9 to cleave exonic gDNA resulting in frameshift mutations and ultimately gene knockout. Available constructs include All-in-One (Cas9 and sgRNA expression) and sgRNA only (no Cas9 expression) – navigate to Custom Option to select the latter. Our CRISPR vectors and viruses are also available in a variety of formats including Lentivirus, AAV and Non-Viral.
  • Gene Name/Gene ID

    ZEB2, 311071
  • Gene Full Name

    zinc finger E-box binding homeobox 2
  • Alias

    KIAA0569, SIP-1
  • Accession Number

  • Species

    Rat
  • System

    Lentiviral Vector
  • Target Sequence

    Target 1: CAGCACCAAATGCTAACCCA
    Target 2: AACTGGCATGAAAACGGAGT
    Target 3: AAGCCCGATCAACCCGTACA
    Target 4: CGAGATAAGGGAGAGCGTTG
  • Promoter

    SFFV-U6
  • Storage Condition

    Store Lentiviral Vectors at -20°C.
  • QC

    Restriction Enzyme Digest and Sequencing
  • Disclaimer

  • Guarantee

    abm guarantees that at least one out of the three sgRNA Lentiviral constructs purchased in a set designed to be used with Cas9 Nuclease will result in complete gene knockout (due to indel) in over 50% of cells at 1 week after successful transduction and drug selection. Click for more info

    ☛ View our CRISPR Workflow Guide to learn how to use our CRISPR KO products and identify key stages in delivery, selection, and screening.

  • Caution

    This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    Publishing research using LG650813? Please let us know so that we can cite the reference in this datasheet.
    LG650813 has not been cited in any literature.
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.

    MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    The concentration must be optimized for each cell type.  Typical selection amounts are around 0.1 - 0.5µg per ml.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Yes.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Optimal cell density for lentiviral transduction is generally 50-70% confluent for most cell types. Certain cell lines may require the optimal cell density to be determined experimentally.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Yes.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Aug 08 2025
    Answer
    abm's lentiviral vectors are compatible with 2nd and 3rd generation packaging systems. We recommend abm’s Second Generation Packaging Mix (Cat. No. LV003) for users who want to achieve higher titer lentivirus as only 3 plasmids are required for virus production instead of 4 plasmids.  We also recommend abm’s Third Generation Packaging Mix (Cat. No. LV053) for users concerned with virus biosafety, as the viral packaging elements are further split into 4 plasmids thus reducing probably of producing wild type virus.

    Please note, only packaging mixes produced by abm have been tested in house and therefore carry our guarantee for high titer virus production. If it is desirable to use other packaging plasmids obtained from a different source, the compatibility must be tested and determined by the end user.
    ABM Scientific Support
    Answered on Aug 08 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Typically vectors are supplied at 100ng/µl.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Yes, all of abm’s lentiviral vectors contain the WPRE (woodchuck hepatitis virus post-transcriptional regulatory element) upstream of the 3’LTR. This element when transcribed creates a tertiary structure which enhances gene expression.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    10^7 IU/ml = DMEM
    10^8, 10^9, 10^10 IU/ml = 1X PBS (pH 7.4) with 2% PEG6000
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 28 2025
    Answer
    10^11 GC/ml = 1X PBS (pH 7.4)
    10^12, 10^13 GC/ml = 1X PBS (pH 7.4)+10% glycerol
    ABM Scientific Support
    Answered on Mar 28 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A general Plasmid Amplification Protocol can be found here.

    We recommend transforming abm’s plasmids into our ProClone™ Competent Cells (Cat. No. E003). The ProClone™ Competent Cells are high-efficiency chemically competent DH5α (E. coli) cells ideal for routine plasmid amplification due to its high yield, rapid growth, and high transformation efficiency, with recA⁻ and endA⁻ mutations that ensure plasmid stability and high DNA quality. Other common compatible cloning strains include TOP10 (DH10B derivatives).
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    1. Use a sterile loop or pipette tip to scrape a small amount of cells from the agar stab. Only a tiny amount is needed as it contains live E. coli.
    2. Gently streak the cells onto an agar plate containing the correct antibiotic selection in order to achieve single isolated colonies.
    3. Place the plate “agar side up” and incubate at 37°C overnight.
    4. Select a single colony from the plate for downstream applications, such as an overnight broth culture and grow E. coli to late exponential-early stationary phase. 4a. The broth culture can be subjected to miniprep plasmid extraction. We recommend using abm’s Column-Pure Plasmid Miniprep Kit (Cat. No. G4003). 4b. The broth culture can be used to prepare a glycerol stock for long-term storage. Mix culture with sterile glycerol to a final concentration of 15% and store at -80°C.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    We recommend first checking the following parameters:
    1. Cell density. If density is too low, this can also result in cell death.
    We recommend the following experiments:
    Initial Experiment
    •Transduce lentivirus into the 293T cell line - one of the easiest cell lines to transduce. If the transduced cells survive selection, then troubleshooting should focus on post-virus production steps. If the transduced cells didn't survive selection, the troubleshooting should focus on virus packaging steps.
    Virus Packaging Troubleshooting
    •Attempt lentivirus packaging using a GFP expressing control vector. If packaging is successful with the control, then repeat packing of the lentivirus in question with a GFP batch control to ensure no errors with the first production. If no GFP signal is observed after transfection or ~72h after a test transduction of a GFP control lentivirus on 293T cells, then the packaging process needs to be assessed.  Packaging process assessment includes reagent quality, cell health, and packaging protocol details.
    Post-Virus Production Troubleshooting
    •Assess if the correct antibiotic concentration is used. This can be done by performing a drug-killing curve. To set up a drug-killing curve, we recommend using the same culture size and seeding density for your actual selection, and adding a different puromycin concentration to each sample, with the range between 0-1 ug/ml. If the cells are not killed at the 1ug/ml, you may try increasing the range higher concentrations. It is important to identify the concentration that results in >95% cell death in 1-4 days to establish the minimal concentration to use for the selection process.
    •Assess if the correct MOI is used to transduce the target cells. This can be done by using a GFP control lentivirus to transduce the target cells at a range around literature-recommended MOIs to determine the optimal MOI for transduction.
    •Assess if a transduction enhancer such as the ViralEntry Transduction Enhancer (Cat.No. G515) is necessary. Some cell lines are more difficult to transduce than others and by using a transduction enhancer can lead to increased target cell permeability.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    1. This often happens to primary cells which are very sensitive to culture medium conditions. Try to use a higher titer virus in order to limit the volume of exogenous media added to your cells.
    2. Virus preparation might be contaminated with bacteria. Use a 0.25µm syringe filter to clear the virus preparation and repeat transduction following strict sterile technique.
    3. Cell line might be contaminated with mycoplasm. This type of contamination is often not immediately obvious. The contamination effect is amplified after virus transduction. Repeat transduction with fresh cells.
    4. The virus preparation may contain some cell debris which could be mistaken as a change in cell morphology. Normally this issue will disappear 3-5 days after virus transduction.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    AAV exhibits natural tropism towards certain cells and tissue types. Therefore your choice of AAV serotype should be dependent on the desired cell type. See our AAV Serotype Selection Chart at this link. Alternatively abm offers an AAV Serotype Blast Kit (Cat. No. AAV099) containing 9 pre-packaging helper-free AAV with GFP expression. This kit can be used to help the user determine a suitable serotype for their desired cell line.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    The sgRNA target sequences for all of abm’s CRISPR knockout vectors (human and mouse) can be found on each individual product’s webpage. Regarding rat specific genes, these sgRNAs are available upon order placement please email technical@abmgood.com
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 29 2026
    Answer
    sgRNAs are primarily selected from widely trusted sources including Feng Zhang’s GEcKO v2 Knockout library  or are designed using a variety of software to evaluate the best sgRNA targets including parameters such as high efficiency, minimal off targets and low self complementarity. We routinely find from in-house CRISPR knockout experiments that at least 1 out of 3 sgRNAs (from a set of 3 sgRNAs) results in successful gene knockout – this is why we always recommend choosing a set of 3 sgRNAs per gene.
    ABM Scientific Support
    Answered on Jan 29 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A complete list of controls can be found on abm’s Control Vectors and Viruses page.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    There could many possible reasons for this result.
    1. Typically GFP is behind a weaker promoter such as SV40 or CBH leading to a less robust fluorescence signal.
    2. Virus titer is low leading to only a small proportion of successfully transduced cells. Try increasing the MOI or using a transduction enhancer such as abm’s ViralEntry™ (Cat.No. G516). 3. Target cells are difficult to transduce. A higher MOI must be tested. Some cells are very easy to be transduced such as 293T, while others such as lymphocytes are very difficult.
    4. Lentivirus became inactivated during transportation and storage. Lentivirus is very sensitive to temperature changes. Leaving lentivirus at room temperature, 4°C for 48 hours, or subjecting it to multiple freeze/thaws can lead to inactivation or reduced titer.
    ABM Scientific Support
    Answered on Mar 24 2025
    Answer
    There could be several possible reasons for this:
    1.. Cells are a mixture of clones, not a single clone. We recommend isolating single cells by serial dilution and then screening and sequencing those cells.
    2. CRISPR gene knock out efficiency is variable and dependent on many different factors (sgRNA, cell type, chromatin accessibility, expression levels of Cas9 etc) therefore it is recommended to screen 50-100 clones in order to identify positive edited clones.
    3. We also recommend abm’s CRISPR Screening Kits (Cat.No. G990 and G932) to increase your accuracy and minimize false positives and negatives.
    ABM Scientific Support
    Answered on Mar 24 2025
    Answer
    There could be several possible reasons for this:
    1. Cells are polyclonal. Cells are a mixture of clones, not a single clone. We recommend isolating single cells by serial dilution and then screening and sequencing and testing those cells.
    2. The cell line may not be diploid, but instead could be triploid or more. In other words, the cells have more than two copies of the same gene. This is a very common phenomenon in cancer cell lines.
    3. The antibody being used may be binding to other proteins from the same family. Assess the antibody and ensure that it only binds to your target protein.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 16 2026
    Answer
    For SpCas9, the PAM sequence is NGG, and it is located on the non-target strand. The sgRNA binds the target strand (the strand complementary to the non-target strand sequence, excluding PAM).
    As a general design rule:
    When cloning sgRNAs, reverse-complement requirements depend on the specific cloning system and oligo design format; customers should follow the cloning instructions for the backbone being used.
    ABM Scientific Support
    Answered on Jan 16 2026
    Answer
    This is a common issue and does not necessarily indicate the KO failed.
    Common causes include:
    (1) KO assessment performed too early
    GFP confirms transfection but does not guarantee functional KO at early time points. With transient systems, knockout efficiency may be limited at 24–48 hours. We recommend waiting 72–96 hours post-transfection before assessing KO outcomes. If possible, proceed with clonal isolation for the most reliable KO validation.
    (2) Protein/mRNA stability (long half-life)
    Many proteins (and transcripts) have long half-lives, so residual signal may persist even after successful editing—especially in a pooled population where editing is heterogeneous.
    Recommended KO validation workflow:
    ABM Scientific Support
    Answered on Jan 16 2026
    Answer

    Complete cell death during puromycin selection most commonly indicates one or more of the following: puromycin concentration is too high for the specific cell line or selection was initiated too early, before sufficient expression of the puromycin resistance gene. To optimize selection, abm recommends the following: 

    1. Perform a puromycin kill curve
    • Test a range of puromycin concentrations (e.g., 0.25–10 µg/mL, depending on the cell type). 
    • Identify the lowest concentration that kills all untransduced control cells within 3–5 days. 
    • Use a slightly lower concentration (typically 0.5×–0.75× of the kill-curve dose) for post-transduction selection. 
    2. Delay antibiotic selection
    • Allow 48–72 hours after transduction before adding puromycin. 
    • This recovery period allows expression the puromycin resistance gene. 
    3. Confirm transduction efficiency
    • Include a positive control lentivirus (e.g., GFP-only or selectable marker–only) to verify infection efficiency. 
    4. Optimize infection conditions
    • Use an appropriate MOI for the target cell type. 
    • Include a transduction enhancer (e.g., polybrene at 4–8 µg/mL, if compatible). 
    ABM Scientific Support
    Answered on Jan 29 2026
    ABM community
    Verified customer
    Asked on Jan 29 2026
    Answer
    • Verify plasmid quality: Confirm the plasmid is intact, at sufficient concentration, and free of contaminants (e.g., salts, ethanol, nucleases).

    • Check the host strain: Use a suitable cloning strain (e.g., recA⁻/endA⁻ such as DH5α) and confirm cells are competent and not expired.

    • Confirm selection conditions: Make sure the correct antibiotic is used at the proper concentration and that plates/media are fresh.

    • Review transformation conditions: Ensure the transformation method (chemical or electrocompetent) and recovery time are appropriate.

    • Assess plasmid compatibility: Large, low-copy, toxic, or unstable plasmids may require specialized strains or growth conditions.

    • Inspect growth conditions: Verify incubation temperature, shaking speed, and culture time.

    • Check plasmid sequence/features: Look for toxic genes, strong promoters, or repeats that may reduce stability.

    ABM Scientific Support
    Answered on Jan 29 2026
    ABM community
    Verified customer
    Asked on Jan 29 2026
    Answer
    CRISPR gene knockout workflows can vary widely and typically require optimization for each experimental system. Outcomes depend on multiple factors, including cell type, target gene, delivery method, and selection strategy. As a result, there is no single universal protocol, and users should expect to optimize conditions for their specific application. General guidelines and example protocols are provided in the linked documentation to support experimental design and optimization.
    ABM Scientific Support
    Answered on Jan 29 2026
    ABM community
    Verified customer
    Asked on May 14 2026
    Answer
    Each experiment is unique and may require optimization depending on the cell type, but here is a helpful CRISPR Workflow Guide to point you in the right direction.
    ABM Scientific Support
    Answered on May 14 2026
    Prev
    Next
    There are currently no reviews for LG650813.
    Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
Zeb2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
Cat. No.
LG650813
Customize Vector
Plasmid DNA Services
Midiprep Plasmid Amplification (3 Plasmids) (Add-on)
10-20 µg each
$225.00
Maxiprep Plasmid Amplification (3 Plasmids) (Add-on)
80-100 µg each
$450.00
3 Bacterial Agar Stabs (Add-on)
3 stabs
$120.00
Virus Packaging Services
Lentivirus packaging at 108 IU/ml Titer, set of 3 viruses (Mini) (Add-on)
3 x 250 µl per virus
$300.00
Lentivirus packaging at 109 IU/ml Titer, set of 3 viruses (Regular) (Add-on)
4 x 100 µl per virus
$900.00
Lentivirus packaging at 1010 IU/ml Titer, set of 3 viruses (Ultra-pure) (Add-on)
10 x 50 µl per virus
$2,200.00
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
K070a
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
K010
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Non-Viral Vector (with spCas9)
K094
1.0 µg
$99.00
Empty
×
Current vector selected:
Cat. No.
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
K070a
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
K010
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Non-Viral Vector (with spCas9)
K094
1.0 µg
$99.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
Zeb2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
LG650813
sgRNA only, set of 3
LG650813-LVgRNA
Lentivirus Packaging at 107 IU/ml Titer
CLV7-LG650813
Lentivirus Packaging at 108 IU/ml Titer
CLV8-LG650813
Lentivirus Packaging at 109 IU/ml Titer
CLV9-LG650813
Lentivirus Packaging at 1010 IU/ml Titer (Ultra-pure)
CLV10-LG650813
;