Lenti-SV40T Virus, High Titer
| Cat. No. | LV665 |
| Name | Lenti-SV40T Virus, High Titer |
| Unit | 2 x 100 μl |
| Unpacking and Storage Instructions |
Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
| Description |
High-titer (109 IU/ml) recombinant lentivirus expressing the SV40 large T antigen (SV40T) without an antibiotic selection marker. Ideal for applications where endogenous or alternative selection strategies are preferred, this vector enables efficient immortalization while preserving flexibility for downstream experimental design, including co-transduction or custom selection workflows. |
| Application |
|
| Shipping Conditions | Dry Ice |
| Expression System Type | Lentivirus |
| Caution |
This product is distributed for laboratory research only. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV665 |
Print/Download Datasheet
| What primers can I use for SV40 large T detection? | |
|
•PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
•qPCR primers: SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
| Do I need to remove antibiotics (penicillin, streptomycin) before immortalizing my cells with the SV40T antigen viruses? | |
|
No. Routine cell culture antibiotics do not interfere with the SV40T antigen virus infection efficiency.
|
| What is the general procedure for immortalizing cells? | |
|
See our Cell Immortalization Handbook for more details.
|
| Can you recommend a specific reagent and protocol to immortalize my cell line? | |
|
Successful cell immortalization is unpredictable and must be determined experimentally, as results vary with species, tissue origin, growth characteristics and whether or not specific cell functions need to be preserved.
Our in-house experiments using the SV40T and hTERT lentiviruses have achieved the highest immortalization success rates in a variety of different cell types. |
| Do immortalized cells retain all characteristics of the original primary cell line? | |
|
Not always. Some phenotypic or genetic changes may occur during immortalization. We recommend using our hTERT immortalization reagents as this method preserves phenotype and karyotype as well as minimizes genomic instability.
|
| Do I need a control when performing cell immortalization experiments? | |
|
Yes. Always include control cells that are not transduced in order to compare growth rates and detect senescence bypass.
|
| How do I confirm successful cell immortalization? | |
|
Assess long-term growth beyond normal passage limits and verify expression of the immortalizing genes via PCR, qPCR or Western blot.
|
| Where can I learn more about cell immortalization? | |
|
Check out our Learning Resources and Youtube video for more information.
|
| How does the SV40T gene immortalize cells? | |
|
SV40T works to shut down p53 and pRb-dependent growth control, thus over-riding the normal safety checkpoints that limit cell division.
|
| Will this virus immortalize my primary cells? | |
|
This is highly dependent on the immortalization reagent and cell type. Check out our Cell Immortalization Reagents Compatibility Chart for more information.
|
- Li An Wu, Feng, J., Wang, L., Yan Dong Mu, Baker, A., Donly, K. J., Jelica Gluhak-Heinrich, Harris, S. E., MacDougall, M., & Chen, S. (2010). Immortalized mouse floxed Bmp2 dental papilla mesenchymal cell lines preserve odontoblastic phenotype and respond to BMP2. Journal of Cellular Physiology, 225(1), 132–139. https://doi.org/10.1002/jcp.22204
- Chen, Q., Sievers, R. E., Varga, M., Kharait, S., Haddad, D. J., Patton, A. K., Delany, C. S., Mutka, S. C., Blonder, J. P., Dubé, G. P., Rosenthal, G. J., & Springer, M. L. (2013). Pharmacological inhibition ofS-nitrosoglutathione reductase improves endothelial vasodilatory function in rats in vivo. Journal of Applied Physiology, 114(6), 752–760. https://doi.org/10.1152/japplphysiol.01302.2012
- Liu, C., Wang, X., Zhang, H., Xie, X., Liu, P., Liu, Y., Jani, P. H., Lu, Y., Chen, S., & Qin, C. (2015). Immortalized Mouse Floxed Fam20c Dental Papillar Mesenchymal and Osteoblast Cell Lines Retain Their Primary Characteristics. Journal of Cellular Physiology, 230(11), 2581–2587. https://doi.org/10.1002/jcp.25008
- Coleman, S., Choi, K. Y., Root, M., & McGregor, A. (2016). A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus. PLOS Pathogens, 12(7), e1005755. https://doi.org/10.1371/journal.ppat.1005755
- Jester, J. V., Potma, E. O., & Brown, D. J. (2016). PPARγ Regulates Mouse Meibocyte Differentiation and Lipid Synthesis. The Ocular Surface, 14(4), 484–494. https://doi.org/10.1016/j.jtos.2016.08.001
- Romana Auciello, Vinay Bulusu, Oon, C., Tait-Mulder, J., Berry, M. F., Bhattacharyya, S., Sergey Tumanov, Allen-Petersen, B. L., Link, J. S., Kendsersky, N. D., Esmee Vringer, Schug, M., Novo, D., Hwang, R. F., Evans, R. M., Nixon, C., Dorrell, C., Morton, J. P., Norman, J. C., & Sears, R. C. (2019). A Stromal Lysolipid–Autotaxin Signaling Axis Promotes Pancreatic Tumor Progression. 9(5), 617–627. https://doi.org/10.1158/2159-8290.cd-18-1212
- Tashiro, K., Segawa, T., Futami, T., Suzuki, M., & Itou, T. (2023). Establishment and characterization of a novel kidney cell line derived from the common bottlenose dolphin. In Vitro Cellular & Developmental Biology - Animal, 59(7), 536–549. https://doi.org/10.1007/s11626-023-00786-y
- Zhou, N., Tian, Y., Wu, H., Cao, Y., Li, R., Zou, K., Xu, W., & Lu, L. (2022). Protective Effect of Resveratrol on Immortalized Duck Intestinal Epithelial Cells Exposed to H2O2. Molecules, 27(11), 3542. https://doi.org/10.3390/molecules27113542
This product has no review yet.
Controls and Related Product: