Lenti-SV40 (tsA58 temperature sensitive mutant) (Puro) Virus, High Titer

Cat. No.

LV630

Unit

2 x 100 µl

Price

$1,025.00

Cat. No.	LV630
Name	Lenti-SV40 (tsA58 temperature sensitive mutant) (Puro) Virus, High Titer
Unit	2 x 100 µl
Unpacking and Storage Instructions	Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
Description	High-titer (10⁹ IU/ml) recombinant lentivirus expressing the temperature-sensitive SV40 large T antigen mutant (tsA58). The tsA58 protein supports cell proliferation under permissive temperatures while allowing conditional regulation of cell growth and differentiation under non-permissive conditions. This system enables generation of conditionally immortalized cell lines that can proliferate during expansion and subsequently undergo differentiation when desired. A puromycin resistance marker enables convenient antibiotic selection following transduction, while high viral titers maximize delivery efficiency across diverse cell types. Temperature-Sensitive Immortalization At the permissive 33°C, the large T antigen is active — driving proliferation and keeping cells immortalized for easy expansion. At the non-permissive 39°C (some protocols cite 38–39.5°C), the mutant protein is inactivated, switching off proliferation so cells revert toward a normal, growth-arrested state ideal for differentiation studies and functional assays.
Application	Conditional cell immortalization Expansion of primary cells prior to differentiation Stem cell and progenitor cell research Developmental biology Regenerative medicine studies
Shipping Conditions	Dry Ice
Expression System Type	Lentivirus
Caution	This product is distributed for laboratory research only.
Material Citation	If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV630

Print/Download Datasheet

Search CoA here

MSDS

Lentivirus MSDS

Supporting Protocol

Cell Immortalization Handbook V8

	What primers can I use for SV40T tsA58 detection?
	•PCR primers: SV40T Forward Primer Sequence 5’ AGCCTGTAGAACCAAACATT 3' SV40T Reverse Primer Sequence 5’ CTGCTGACTCTCAACATTCT 3' Expected band size: 792bp •qPCR primers: SV40 Forward Primer Sequence TTCCCTGACCTGAAGGCAAATC SV40 Reverse Primer Sequence GGCTGAACTTTGAGCTAGGAGTAG

	Do I need to remove antibiotics (penicillin, streptomycin) before immortalizing my cells with the SV40T antigen viruses?
	No. Routine cell culture antibiotics do not interfere with the SV40T antigen virus infection efficiency.

	What is the general procedure for immortalizing cells?
	See our Cell Immortalization Handbook for more details.

	Can you recommend a specific reagent and protocol to immortalize my cell line?
	Successful cell immortalization is unpredictable and must be determined experimentally, as results vary with species, tissue origin, growth characteristics and whether or not specific cell functions need to be preserved. Our in-house experiments using the SV40T and hTERT lentiviruses have achieved the highest immortalization success rates in a variety of different cell types.

	Do immortalized cells retain all characteristics of the original primary cell line?
	Not always. Some phenotypic or genetic changes may occur during immortalization. We recommend using our hTERT immortalization reagents as this method preserves phenotype and karyotype as well as minimizes genomic instability.

	Do I need a control when performing cell immortalization experiments?
	Yes. Always include control cells that are not transduced in order to compare growth rates and detect senescence bypass.

	How do I confirm successful cell immortalization?
	Assess long-term growth beyond normal passage limits and verify expression of the immortalizing genes via PCR, qPCR or Western blot.

	Where can I learn more about cell immortalization?
	Check out our Learning Resources and Youtube video for more information.

	How does the SV40T gene immortalize cells?
	SV40T works to shut down p53 and pRb-dependent growth control, thus over-riding the normal safety checkpoints that limit cell division.

	Will this virus immortalize my primary cells?
	This is highly dependent on the immortalization reagent and cell type. Check out our Cell Immortalization Reagents Compatibility Chart for more information.

Alicka, M.; Kornicka-Garbowska, K.; Roecken, M.; Marycz, K. Inhibition of the Low Molecular Weight Protein Tyrosine Phosphatase (LMPTP) as a Potential Therapeutic Strategy for Hepatic Progenitor Cells Lipotoxicity—Short Communication. Int. J. Mol. Sci. 2019, 20, 5873. https://doi.org/10.3390/ijms20235873. Application: Cell Immortalization
J. Chun, J. Zhang, M.S. Wilkins, B. Subramanian, C. Riella, J.M. Magraner, S.L. Alper, D.J. Friedman, & M.R. Pollak, Recruitment of APOL1 kidney disease risk variants to lipid droplets attenuates cell toxicity, Proc. Natl. Acad. Sci. U.S.A. 116 (9) 3712-3721, https://doi.org/10.1073/pnas.1820414116 (2019). Application: Cell Immortalization
Liu, Z. et al. WNK1 kinase activity is required for maintenance of podocyte foot process structure. bioRxiv (2025). doi: https://doi.org/10.1101/2025.05.30.657136. Application: Cell Immortalization
Liu Z, Lee E, Jiang S, Yoon J, Ahmed F, Rahman MA, Bleicher P, Suleiman HY, Bruggeman LA, Miller RT, Chang AN. WNK1 Kinase Activity Is Required for the Functional Maintenance of Podocyte Structure. FASEB J. 2026 Feb 28;40(4):e71551. doi: 10.1096/fj.202503839R. PMID: 41669953; PMCID: PMC12892244. Application: Cell Immortalization
Yoon, Joonho et al. Glomerular Elastic Modulus and Gene Expression Patterns Define Two Phases of Alport Nephropathy. bioRxiv 2024.02.26.582201; doi: https://doi.org/10.1101/2024.02.26.582201. Application: Cell Immortalization