Lenti-SV40Tt Virus, High Titer
| Cat. No. | LV614 |
| Name | Lenti-SV40Tt Virus, High Titer |
| Unit | 2 x 100 µl |
| Unpacking and Storage Instructions |
Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
| Description |
High-titer (109 IU/ml) recombinant lentivirus expressing both the SV40 large T and small t antigens (SV40Tt) for enhanced immortalization of mammalian cells. Co-expression of the two viral antigens promotes efficient bypass of cellular growth restrictions and supports the establishment of continuously proliferating cell lines, particularly for cell types that are difficult to immortalize using SV40 large T antigen alone. |
| Application |
|
| Shipping Conditions | Dry Ice |
| Expression System Type | Lentivirus |
| Caution |
This product is distributed for laboratory research only. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV614 |
Print/Download Datasheet
|
What PCR primers can I use for SV40Tt detection?
|
|
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
|
|
What qPCR primers can I use for SV40Tt detection?
|
|
|
SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
| Do I need to remove antibiotics (penicillin, streptomycin) before immortalizing my cells with the SV40T antigen viruses? | |
|
No. Routine cell culture antibiotics do not interfere with the SV40T antigen virus infection efficiency.
|
| What is the general procedure for immortalizing cells? | |
|
See our Cell Immortalization Handbook for more details.
|
| Can you recommend a specific reagent and protocol to immortalize my cell line? | |
|
Successful cell immortalization is unpredictable and must be determined experimentally, as results vary with species, tissue origin, growth characteristics and whether or not specific cell functions need to be preserved.
Our in-house experiments using the SV40T and hTERT lentiviruses have achieved the highest immortalization success rates in a variety of different cell types. |
| Do immortalized cells retain all characteristics of the original primary cell line? | |
|
Not always. Some phenotypic or genetic changes may occur during immortalization. We recommend using our hTERT immortalization reagents as this method preserves phenotype and karyotype as well as minimizes genomic instability.
|
| Do I need a control when performing cell immortalization experiments? | |
|
Yes. Always include control cells that are not transduced in order to compare growth rates and detect senescence bypass.
|
| How do I confirm successful cell immortalization? | |
|
Assess long-term growth beyond normal passage limits and verify expression of the immortalizing genes via PCR, qPCR or Western blot.
|
| Where can I learn more about cell immortalization? | |
|
Check out our Learning Resources and Youtube video for more information.
|
| How does the SV40T gene immortalize cells? | |
|
SV40T works to shut down p53 and pRb-dependent growth control, thus over-riding the normal safety checkpoints that limit cell division.
|
| Will this virus immortalize my primary cells? | |
|
This is highly dependent on the immortalization reagent and cell type. Check out our Cell Immortalization Reagents Compatibility Chart for more information.
|
- Wang, Z., Paris, L. L., Chihara, R. K., A. Joseph Tector, & Burlak, C. (2012). Immortalized porcine liver sinusoidal endothelial cells: an in vitro model of xenotransplantation‐induced thrombocytopenia. Xenotransplantation, 19(4), 249–255. https://doi.org/10.1111/j.1399-3089.2012.00715.x
- Wang, Z.-Y., Li, P., Butler, J. R., Blankenship, R. L., Downey, S. M., Montgomery, J. B., Nagai, S., Estrada, J. L., Tector, M. F., & Tector, A. J. (2016). Immunogenicity of Renal Microvascular Endothelial Cells From Genetically Modified Pigs. Transplantation, 100(3), 533–537. https://doi.org/10.1097/tp.0000000000001070
-
Ibrahim, A.G. et al. Engineered extracellular vesicles antagonize SARS-CoV-2 infection by inhibiting mTOR signaling. Biomaterials and Biosystems, Volume 6, 2022, 100042.
DOI: 10.1016/j.bbiosy.2022.100042.
This product has no review yet.
Controls and Related Product: