Retro-SV40LT Virus
| Cat. No. | RVP010 |
| Name | Retro-SV40LT Virus |
| Unit | 5 x 50 µl |
| Unpacking and Storage Instructions |
For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
| Description |
Replication-incompetent retrovirus expressing the SV40 large T antigen (SV40LT) at 108 IU/ml titer for stable immortalization of proliferating mammalian cells. Genomic integration provides durable expression of SV40LT, supporting continuous cell growth and enabling the establishment of renewable cellular models for basic and translational research. |
| Application |
|
| Shipping Conditions | Ice Pack |
| Expression System Type | Retrovirus |
| Caution |
This product is distributed for laboratory research only. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. RVP010 |
Print/Download Datasheet
Search CoA here
Supporting Protocol
| What primers can I use for SV40 large T detection? | |
|
•PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
•qPCR primers: SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
| Do I need to remove antibiotics (penicillin, streptomycin) before immortalizing my cells with the SV40T antigen viruses? | |
|
No. Routine cell culture antibiotics do not interfere with the SV40T antigen virus infection efficiency.
|
| What is the general procedure for immortalizing cells? | |
|
See our Cell Immortalization Handbook for more details.
|
| Can you recommend a specific reagent and protocol to immortalize my cell line? | |
|
Successful cell immortalization is unpredictable and must be determined experimentally, as results vary with species, tissue origin, growth characteristics and whether or not specific cell functions need to be preserved.
Our in-house experiments using the SV40T and hTERT lentiviruses have achieved the highest immortalization success rates in a variety of different cell types. |
| Do immortalized cells retain all characteristics of the original primary cell line? | |
|
Not always. Some phenotypic or genetic changes may occur during immortalization. We recommend using our hTERT immortalization reagents as this method preserves phenotype and karyotype as well as minimizes genomic instability.
|
| Do I need a control when performing cell immortalization experiments? | |
|
Yes. Always include control cells that are not transduced in order to compare growth rates and detect senescence bypass.
|
| How do I confirm successful cell immortalization? | |
|
Assess long-term growth beyond normal passage limits and verify expression of the immortalizing genes via PCR, qPCR or Western blot.
|
| Where can I learn more about cell immortalization? | |
|
Check out our Learning Resources and Youtube video for more information.
|
| How does the SV40T gene immortalize cells? | |
|
SV40T works to shut down p53 and pRb-dependent growth control, thus over-riding the normal safety checkpoints that limit cell division.
|
| Will this virus immortalize my primary cells? | |
|
This is highly dependent on the immortalization reagent and cell type. Check out our Cell Immortalization Reagents Compatibility Chart for more information.
|
- Qiu, Luping et al. In vitro NIH3T3 mouse embryonic fibroblast cell model does not predict AAV2 or AAVdj-mediated cell transformation. Toxicology and Applied Pharmacology, Volume 495, 2025, 117229. https://doi.org/10.1016/j.taap.2025.117229. Application: Cell Immortalization
This product has no review yet.
Controls and Related Product: