Retro-SV40T Virus
| Cat. No. | G212 |
| Name | Retro-SV40T Virus |
| Unit | 5 x 50 µl |
| Unpacking and Storage Instructions |
For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
| Description |
Replication-incompetent retrovirus (108 IU/ml) expressing the SV40 large T and small T antigens for stable genomic integration into dividing mammalian cells. Retroviral delivery enables long-term SV40T expression, facilitating the establishment of immortalized cell lines for sustained experimental use and routine cell culture applications. |
| Application |
|
| Shipping Conditions | Ice Pack |
| Caution |
This product is distributed for laboratory research only. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. G212 |
Print/Download Datasheet
Search CoA here
Supporting Protocol
| What do I use to check if my cells were successfully immortalized by the SV40 agent? | |
|
We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html
|
| What are the primers to use for SV40 identification? | |
|
SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.
|
| What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors? | |
|
There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.
|
| What is the accession number for the SV40? | |
|
The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers: SV40T Forward Primer Sequence 5’ AGCCTGTAGAACCAAACATT 3' SV40T Reverse Primer Sequence 5’ CTGCTGACTCTCAACATTCT 3' The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
|
What primers can I use for SV40 detection?
|
|
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
qPCR Primers: SV40T Forward Primer Sequence 5' TTCCCTGACCTGAAGGCAAATC 3' SV40T Reverse Primer Sequence 5' GGCTGAACTTTGAGCTAGGAGTAG 3' |
| Do I need to remove antibiotics (penicillin, streptomycin) before immortalizing my cells with the SV40T antigen viruses? | |
|
No. Routine cell culture antibiotics do not interfere with the SV40T antigen virus infection efficiency.
|
| What is the general procedure for immortalizing cells? | |
|
See our Cell Immortalization Handbook for more details.
|
| Can you recommend a specific reagent and protocol to immortalize my cell line? | |
|
Successful cell immortalization is unpredictable and must be determined experimentally, as results vary with species, tissue origin, growth characteristics and whether or not specific cell functions need to be preserved.
Our in-house experiments using the SV40T and hTERT lentiviruses have achieved the highest immortalization success rates in a variety of different cell types. |
| Do immortalized cells retain all characteristics of the original primary cell line? | |
|
Not always. Some phenotypic or genetic changes may occur during immortalization. We recommend using our hTERT immortalization reagents as this method preserves phenotype and karyotype as well as minimizes genomic instability.
|
| Do I need a control when performing cell immortalization experiments? | |
|
Yes. Always include control cells that are not transduced in order to compare growth rates and detect senescence bypass.
|
| How do I confirm successful cell immortalization? | |
|
Assess long-term growth beyond normal passage limits and verify expression of the immortalizing genes via PCR, qPCR or Western blot.
|
| Where can I learn more about cell immortalization? | |
|
Check out our Learning Resources and Youtube video for more information.
|
| How does the SV40T gene immortalize cells? | |
|
SV40T works to shut down p53 and pRb-dependent growth control, thus over-riding the normal safety checkpoints that limit cell division.
|
| Will this virus immortalize my primary cells? | |
|
This is highly dependent on the immortalization reagent and cell type. Check out our Cell Immortalization Reagents Compatibility Chart for more information.
|
- Narendra, DP;Jin, SM;Tanaka, A;Suen, DF;Gautier, CA;Shen, J;Cookson, MR;Youle, RJ;, et al. "PINK1 is selectively stabilized on impaired mitochondria to activate Parkin" PLoS Biol. 8-1:e1000298 (2010). PubMed: 20126261.
- Hu, B., Moiseev, D., Schena, I., Faezov, B., Dunbrack, R., Chernoff, J., & Li, J. (2023). PAK2 is necessary for myelination in the peripheral nervous system. Brain, 147(5), 1809–1821. https://doi.org/10.1093/brain/awad413
This product has no review yet.
Controls and Related Product: